Journal: Antioxidants

Article Title: Antioxidant and Immune Stimulating Effects of Allium cepa Skin in the RAW 264.7 Cells and in the C57BL/6 Mouse Immunosuppressed by Cyclophosphamide

doi: 10.3390/antiox12040892

Figure Lengend Snippet: Effects of A. cepa skin (OS) extracts on the productions of ( a ) IL-1β, ( b ) IFN-γ, and ( c ) TNF-α by RAW 264.7 cells. Data was expressed as the mean ± SEM. a–e Different letters are significantly different at p < 0.05.

Article Snippet: Primers (GAPDH (QT01658692), IL-1β (QT01048355), IL-6 (QT00098875), IFN-γ (QT01038821), and TNF-α (QT00104006)) for cytokine expression were purchased from QIAGEN GmbH (Hilden, Germany).

Techniques:

Journal: Antioxidants

Article Title: Antioxidant and Immune Stimulating Effects of Allium cepa Skin in the RAW 264.7 Cells and in the C57BL/6 Mouse Immunosuppressed by Cyclophosphamide

doi: 10.3390/antiox12040892

Figure Lengend Snippet: Effects of A. cepa skin (OS) extracts on the expressions of ( a ) IL-1 β, ( b ) IL-6, ( c ) IFN- γ, and ( d ) TNF-α by RAW 264.7 cells. Data was expressed as the mean ± SEM. a–e Different letters are significantly different at p < 0.05.

Article Snippet: Primers (GAPDH (QT01658692), IL-1β (QT01048355), IL-6 (QT00098875), IFN-γ (QT01038821), and TNF-α (QT00104006)) for cytokine expression were purchased from QIAGEN GmbH (Hilden, Germany).

Techniques:

Journal: Antioxidants

Article Title: Antioxidant and Immune Stimulating Effects of Allium cepa Skin in the RAW 264.7 Cells and in the C57BL/6 Mouse Immunosuppressed by Cyclophosphamide

doi: 10.3390/antiox12040892

Figure Lengend Snippet: Effects of A. cepa skin (OS) extract on the serum ( a ) IL-1β and ( b ) IFN-γ levels in C57BL/6 mice immunosuppressed by cyclophosphamide (CPA). NOR, normal control group; NC, negative control group; PC, positive control group; OS100, OS extract 100 mg/kg BW; OS200, OS extract 200 mg/kg BW. Data was expressed as the mean ± SEM. a,b Different letters are significantly different at p < 0.05. NS Not significantly different.

Article Snippet: Primers (GAPDH (QT01658692), IL-1β (QT01048355), IL-6 (QT00098875), IFN-γ (QT01038821), and TNF-α (QT00104006)) for cytokine expression were purchased from QIAGEN GmbH (Hilden, Germany).

Techniques: Negative Control, Positive Control

Journal: Journal of Cellular Physiology

Article Title: The Androgen Receptor Regulates PPARγ Expression and Activity in Human Prostate Cancer Cells

doi: 10.1002/jcp.25368

Figure Lengend Snippet: The androgen DHT reduces PPARγ mRNA in AR‐positive cells. (A) qRT‐PCR was used to detect basal levels of total PPARγ and PPARγ2 mRNA in total RNA samples from human prostate cancer cell lines and adipose tissue RNA. The amount of PPARγ mRNA in each sample was normalized to 18S rRNA. Black bars represent the normalized amount of total PPARγ (PPARγ1 and PPARγ2) while the gray bars represent PPARγ2 mRNA. (B) C4‐2 cells were treated with EtOH or different concentrations of DHT for 24 h. Total RNA was then isolated from treated cells. The amount of PPARγ mRNA and 18S rRNA in each RNA sample was measured using qRT‐PCR. (C) C4‐2 cells were treated with EtOH (gray bars) or 1 nM DHT (black bars) for 3–24 h. PPARγ mRNA and 18S rRNA levels in each sample were then measured using qRT‐PCR. (D) VCaP cells were treated for 24 h with either EtOH or increasing concentrations of DHT. The level of PPARγ and 18S RNA in treated cells was then measured by qRT‐PCR. In parts A–D, each bar represents the mean ± SEM of three independent samples. * P < 0.05 compared to EtOH group.

Article Snippet: The Qiagen PPARγ primer set (HsPPARG_1_SG Quantitect Primer Cat. #ATT00029841), PPARγ2 Forward (GACCACTCCCACTCCTTTGA) and Reverse (5′‐TCCATGCTGTTATGGGTGAA) primers, as well as the 18S Forward (5′‐ATC AAC TTT CGA TGG TAG TCG‐3′) and 18S Reverse (5′‐TCC TTG GAT GTG GTA GCG‐3′) primers were used to detect the presence of total PPARγ mRNA, PPARγ2 mRNA and 18S rRNA.

Techniques: Quantitative RT-PCR, Isolation

Journal: Scientific Reports

Article Title: MSC from fetal and adult lungs possess lung-specific properties compared to bone marrow-derived MSC

doi: 10.1038/srep29160

Figure Lengend Snippet: MSC isolated from lung-transplanted patients with a chronic rejection (n = 6) showed no difference in the gene expression of Sox 9 ( a ) FAR2 ( b ) and NDUFS5 ( c ) compared to the good outcome recipients (n = 8) when analyzed total RNA by q-PCR. Data are presented as median and statistical analysis was performed by non-parametric Mann-Whitney test. The production of Macrophage migration inhibitor factor (MIF) ( d ) Monocyte chemotactic protein 1/CCL2 ( e ) and Plasminogen activator inhibitor-1/Serpin E1 ( f ) was measured in conditioned medium (24 hours of culture) from adult lung MSC with and without the development of BOS. Data are presented as median and statistical analysis was performed by the non-parametric Mann-Whitney test. *p < 0.05.

Article Snippet: The following primers assays were used: Hs_SOX9_1_SG QuantiTect Primer Assay (cat. no. QT00001498) 111 (NM_000346), Hs_FAR2_1_SG QuantiTect Primer Assay (cat. no. QT00043750), Hs_NDUFS5_1_SG QuantiTect Primer Assay (cat. no. QT00079079), Hs_RRN18S_1_SG QuantiTect Primer Assay (cat. no. QT00199367), Hs_HOXB5_1_SG QuantiTect Primer Assay (cat. no. QT00026740) and Hs_FOXF1_1SG QuantiTect Primer Assay (cat. no. QT00029687) (all from Qiagen).

Techniques: Isolation, Expressing, MANN-WHITNEY, Migration

Journal: Experimental cell research

Article Title: Matrix mineralization controls gene expression in osteoblastic cells

doi: 10.1016/j.yexcr.2018.09.005

Figure Lengend Snippet: (A-C) Detailed plots of examined gene sets and comprising genes enriched on demineralized bone surfaces. Genes within shown gene sets are ranked by measured log2 FC and defined cut-off. Differentially expressed genes are color-marked, depicting a well-established (dark green), a less-reported (light green) and a currently not known (purple) function in osteoblasts. (D) Top 10 upregulated genes on mineralized and demineralized bone surfaces. (E-H) QRTPCR results with measured foldchanges of relative gene expression between mineralized and demineralized bone surfaces. Relative gene expression of mineralized bone surfaces was set to one, serving as reference. Means with standard deviation are shown. Significance was denoted as **p<0.01 and ***p< 0.001. (G and H) Immunofluorescence staining for HMCN1 (red channel) on MG63 cells seeded onto demineralized bone surface. Cell nuclei were co-stained with DAPI (blue channel). Abbreviations: demin, demineralized; min, mineralized.

Article Snippet: The following ten commercial primer sets QuantiTect Primer Assay (Qiagen) were used to detect targets of interest: HMCN1 (Hs_HMCN1_1_SG, Cat. no.: QT00011228), NID2 (Hs_NID2_1_SG, Cat. no.: QT00055258), ITGA2 (Hs_ITGA2_1_SG, Cat. no.: QT00086695), VCAN (Hs_VCAN_1_SG, Cat. no.: QT00064064), GAPDH (Hs_GAPDH_1_SG, Cat. no.: QT00079247) and ACTB (Hs_ACTB_1_SG, Cat. no.: QT00095431).

Techniques: Expressing, Standard Deviation, Immunofluorescence, Staining